MotifBLOCK
An AI-native molecular biology workbench for Claude Science: Claude opens sequence files and prepares analyses on request; you annotate, align, and review them in an interactive workspace.
Overview
From the repository's own README, as read at the audited commit. Badges and raw HTML are left out.
Website · Codex setup · Claude Science setup · Capabilities · Examples · Security
Motif is an AI-native molecular-biology workbench for exploring, editing, annotating, aligning, comparing, and sharing DNA, RNA, and protein records and analysis results. Its core is a self-contained HTML workspace that can run on its own or open through an AI host. The same Motif runtime supports sequence records, maps, annotations, alignments, cloning workflows, Sanger traces, provenance, checkpoints, and portable exports.
Ways to use Motif
The Codex local plugin and Claude Science adapter expose the same workbench tools. motif_open_workbench opens the interactive MCP App, and motif_create_workbench_artifact returns a portable HTML workbench. After opening Motif, confirm that the expected records and active view are visible.
a67f6eee72aeOBSERVED · 2026-10-08Connect
Built from this server's own package name, version and transport as found in its source — not copied from anyone's documentation, so it cannot drift against a page we do not control.
claude mcp add motif-for-claude-science -- npx -y [email protected]
{
"mcpServers": {
"motif-for-claude-science": {
"command": "npx",
"args": [
"-y",
"[email protected]"
]
}
}
}Exposed tools (4)
2 read · 2 write · 0 destructive.
| Tool | Risk | Description |
|---|---|---|
GreenGate | write | GreenGate (Lampropoulos et al.) — BsaI plant kit with 7 modules in a fixed order. |
MoClo-CIDAR | read | CIDAR MoClo (Iverson et al.) — BsaI bacterial-circuit standard parts (Promoter / RBS / CDS / Terminator). |
motif | read | Molecular biology workbench |
motif_create_workbench_artifact | write |
Trust audit
BLOCKgrade D · trust 69/100 Do not install this without reading the findings. The audit found something that could harm you or your machine.
| Layer | What it checks | Result |
|---|---|---|
| L0 | Provenance & inventory | FAIL |
| L1 | Static analysis of the code | WARN |
| L2 | Instruction surface (what it tells the agent) | PASS |
| L3 | Class-specific surface | PASS |
| L4 | Behavioural (sandbox) | SKIPPED |
What the source does
- Filesystem
- declared (6 observation(s))
- Network
- none-observed
- Shell
- none-observed
- Dependencies
- pinned
- Secrets in source
- none-found
Findings (23)
payload.ts
console.log(`✓ check-css-tokens: ${references.size} unique var(--token) references, all resolved.`);"sequence": "TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAT
"sequence": "TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGAT
"sequence": "GAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCA
"sequence": "CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTC
if (result.rejections.tmDiff > 0) reasons.push(`${result.rejections.tmDiff.toLocaleString()} pairings exceeded ΔTm 5 °C`);case 'cross-dimer-cutoff': return 'Cross-dimer ΔG is below the default −5 kcal/mol review cutoff.';
{!validationMessage && pairs.length > 0 ? <span className="motif-cs-primer-result-badge">Best ΔTm {pairs[0].tmDifference.toFixed(1)} °C</span> : null}<span><small>ΔTm</small><strong>{pair.tmDifference.toFixed(1)} °C</strong></span><Metric label="Hairpin ΔG" value={`${hairpin.deltaG.toFixed(1)}${hairpin.status === 'exact' ? '' : ' · review'}`} state={qualityState(hairpin.deltaG, -3, hairpin.status)} />.gitleaksignore
import { VALID_NCBI_TABLE_IDS } from '../../src/bio/codon-tables.js';import { parseFasta } from '../../src/bio/fasta-parser.js';import { parseGenBank } from '../../src/bio/genbank-parser.js';import { resolveFeatureColor } from '../../src/bio/feature-palette.js';import { normalizeSequenceStrict } from '../../src/bio/sequence-normalization.js';baseURL: `http://127.0.0.1:${port}`,url: `http://127.0.0.1:${port}/motif.html`,baseURL: `http://127.0.0.1:${port}`,url: `http://127.0.0.1:${port}/motif.html`,const REFERENCE_SEQUENCE = 'TCCGGGTCCACTCAATAGGGCCTATGGTGTTAAATATGTGTCTCTTGTTCGCTAGGGTGATAGCAAAAAATATAGTGCCTGCTTTTGTGGATGTAAATAATAACTCGCCCCCCTCCCTCACGAGAGCGCTACGCAAACGTATTTGCCGCCCGCCCTTGGTCAGACATTAGCA
src/artifacts/motif-artifact.tsx
Gates applied: no_behavioural_pass.
a67f6eee72aefull audit observations/trust-audit/mcp-server/jvogan__motif.json · Report an issue / request a re-scanAudit history
Every audit this server has had. A grade with a past is a grade somebody is still checking.
| Date | Source | Verdict | Grade | Score | Change |
|---|---|---|---|---|---|
| 2026-10-08 | a67f6eee72ae | BLOCK | D | 69 | first audit |
Questions
What is the Motif MCP server?
An AI-native molecular biology workbench for Claude Science: Claude opens sequence files and prepares analyses on request; you annotate, align, and review them in an interactive workspace.
What tools does Motif expose?
4 in total: 2 read-only, 2 that write, and 0 that can delete or overwrite. Every one is listed on this page with its risk.
Is Motif safe to connect to an agent?
No — not without reading the findings first. The audit graded it D (69/100) and found 1 critical or high issue in the source. Each one is listed on this page with the file and line it is on.
What credentials does Motif need?
No credential environment variables were found in its source, so it appears to need none.
How does Motif run?
It speaks stdio, so it runs as a local process your client starts. It is published on npm as motif-for-claude-science at 0.4.0.
How current is this page?
The grade is for one exact copy of the source (a67f6eee72ae), read on 2026-10-08. The repository is watched and re-audited when it changes.